Abclonal Laboratories manufactures the erlin2 abclonal reagents distributed by Genprice. The Erlin2 Abclonal reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Abclonal. Other Erlin2 products are available in stock. Specificity: Erlin2 Category: Abclonal
CAMK2D Rabbit pAb |
Abclonal |
200 ul |
EUR 459 |
CAMK2D Rabbit pAb |
Abclonal |
20 ul |
EUR 183 |
CAMK2D Rabbit pAb |
Abclonal |
50 ul |
EUR 223 |
Serum / Plasma information
ERLIN2 antibody |
70R-17144 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal ERLIN2 antibody |
ERLIN2 antibody |
70R-5388 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal ERLIN2 antibody raised against the middle region of ERLIN2 |
ERLIN2 Antibody |
1-CSB-PA007791ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against ERLIN2. Recognizes ERLIN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
ERLIN2 Antibody |
1-CSB-PA007791ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against ERLIN2. Recognizes ERLIN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
ERLIN2 Antibody |
1-CSB-PA007791GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against ERLIN2. Recognizes ERLIN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
ERLIN2 Antibody |
1-CSB-PA007791LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ERLIN2. Recognizes ERLIN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
ERLIN2 siRNA |
20-abx901770 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ERLIN2 siRNA |
20-abx915646 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ERLIN2 siRNA |
20-abx915647 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ERLIN2 Polyclonal Antibody |
31505-100ul |
SAB |
100ul |
EUR 252 |
ERLIN2 Polyclonal Antibody |
31505-50ul |
SAB |
50ul |
EUR 187 |
ERLIN2 Blocking Peptide |
33R-1518 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ERLIN2 antibody, catalog no. 70R-5388 |
ERLIN2 cloning plasmid |
CSB-CL007791HU1-10ug |
Cusabio |
10ug |
EUR 238 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 459
- Sequence: atggctcagttgggagcagttgtggctgtggcttccagtttcttttgtgcatctctcttctcagctgtgcacaagatagaagagggacatattggggtatattacagaggcggtgccctgctgacttcgaccagcggccctggtttccatctcatgctccctttcatcacatcata
- Show more
|
Description: A cloning plasmid for the ERLIN2 gene. |
ERLIN2 cloning plasmid |
CSB-CL007791HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 621
- Sequence: atggctcagttgggagcagttgtggctgtggcttccagtttcttttgtgcatctctcttctcagctgtgcacaagatagaagagggacatattggggtatattacagaggcggtgccctgctgacttcgaccagcggccctggtttccatctcatgctccctttcatcacatcata
- Show more
|
Description: A cloning plasmid for the ERLIN2 gene. |
anti- ERLIN2 antibody |
FNab02849 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: ER lipid raft associated 2
- Uniprot ID: O94905
- Gene ID: 11160
- Research Area: Metabolism
|
Description: Antibody raised against ERLIN2 |
Anti-ERLIN2 antibody |
STJ110612 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the SPFH domain-containing family of lipid raft-associated proteins. The encoded protein is localized to lipid rafts of the endoplasmic reticulum and plays a critical role in inositol 1,4,5-trisphosphate (IP3) signaling by mediating ER-associated degradation of activated IP3 receptors. Mutations in this gene are a cause of spastic paraplegia-18 (SPG18). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. |