Erlin2 Abclonal

ERLIN2 Rabbit pAb

A8314-100ul 100 ul
EUR 308

Abclonal Laboratories manufactures the erlin2 abclonal reagents distributed by Genprice. The Erlin2 Abclonal reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Abclonal. Other Erlin2 products are available in stock. Specificity: Erlin2 Category: Abclonal

CAMK2D Rabbit pAb

200 ul
EUR 459

CAMK2D Rabbit pAb

20 ul
EUR 183

CAMK2D Rabbit pAb

50 ul
EUR 223

ZO-1 Rabbit pAb

100 ul
EUR 308

ZO-1 Rabbit pAb

200 ul
EUR 459

ZO-1 Rabbit pAb

20 ul
EUR 183

ZO-1 Rabbit pAb

50 ul
EUR 223

Serum / Plasma information

ERLIN2 antibody

70R-17144 50 ul
EUR 435
Description: Rabbit polyclonal ERLIN2 antibody

ERLIN2 antibody

70R-5388 50 ug
EUR 467
Description: Rabbit polyclonal ERLIN2 antibody raised against the middle region of ERLIN2

ERLIN2 Antibody

1-CSB-PA007791ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ERLIN2. Recognizes ERLIN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ERLIN2 Antibody

1-CSB-PA007791ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ERLIN2. Recognizes ERLIN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

ERLIN2 Antibody

1-CSB-PA007791GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ERLIN2. Recognizes ERLIN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ERLIN2 Antibody

1-CSB-PA007791LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERLIN2. Recognizes ERLIN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

ERLIN2 siRNA

20-abx901770
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ERLIN2 siRNA

20-abx915646
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ERLIN2 siRNA

20-abx915647
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ERLIN2 Polyclonal Antibody

31505-100ul 100ul
EUR 252

ERLIN2 Polyclonal Antibody

31505-50ul 50ul
EUR 187

ERLIN2 Blocking Peptide

33R-1518 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ERLIN2 antibody, catalog no. 70R-5388

ERLIN2 cloning plasmid

CSB-CL007791HU1-10ug 10ug
EUR 238
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 459
  • Sequence: atggctcagttgggagcagttgtggctgtggcttccagtttcttttgtgcatctctcttctcagctgtgcacaagatagaagagggacatattggggtatattacagaggcggtgccctgctgacttcgaccagcggccctggtttccatctcatgctccctttcatcacatcata
  • Show more
Description: A cloning plasmid for the ERLIN2 gene.

ERLIN2 cloning plasmid

CSB-CL007791HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 621
  • Sequence: atggctcagttgggagcagttgtggctgtggcttccagtttcttttgtgcatctctcttctcagctgtgcacaagatagaagagggacatattggggtatattacagaggcggtgccctgctgacttcgaccagcggccctggtttccatctcatgctccctttcatcacatcata
  • Show more
Description: A cloning plasmid for the ERLIN2 gene.

anti- ERLIN2 antibody

FNab02849 100µg
EUR 505.25
  • Immunogen: ER lipid raft associated 2
  • Uniprot ID: O94905
  • Gene ID: 11160
  • Research Area: Metabolism
Description: Antibody raised against ERLIN2

Anti-ERLIN2 antibody

PAab02849 100 ug
EUR 355

Anti-ERLIN2 antibody

STJ110612 100 µl
EUR 277
Description: This gene encodes a member of the SPFH domain-containing family of lipid raft-associated proteins. The encoded protein is localized to lipid rafts of the endoplasmic reticulum and plays a critical role in inositol 1,4,5-trisphosphate (IP3) signaling by mediating ER-associated degradation of activated IP3 receptors. Mutations in this gene are a cause of spastic paraplegia-18 (SPG18). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.