Abbexa Cfhr5

CFHR5 siRNA
20-abx911595
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Abbexa Laboratories manufactures the abbexa cfhr5 reagents distributed by Genprice. The Abbexa Cfhr5 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Abbexa. Other Abbexa products are available in stock. Specificity: Abbexa Category: Cfhr5

Complement Factor H Related Protein 5 (CFHR5) Antibody
  • EUR 1316.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Complement Factor H-Related Protein 5 (CFHR5) Antibody
100 ug
EUR 411
  • Shipped within 5-10 working days.

Complement Factor H-Related Protein 5 (CFHR5) Antibody
100 ug
EUR 411
  • Shipped within 5-10 working days.

Complement Factor H Related Protein 5 (CFHR5) Antibody
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Human Complement Factor H Related 5 (CFHR5) ELISA Kit
96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Complement Factor H Related Protein 5 (CFHR5) Protein
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Complement Factor H Related Protein 5 (CFHR5) CLIA Kit
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Serum / Plasma information

CFHR5 Conjugated Antibody
C48416 100ul
EUR 397

CFHR5 Rabbit pAb
A10367-100ul 100 ul
EUR 308

CFHR5 Rabbit pAb
A10367-200ul 200 ul
EUR 459

CFHR5 Rabbit pAb
A10367-20ul 20 ul
EUR 183

CFHR5 Rabbit pAb
A10367-50ul 50 ul
EUR 223

CFHR5 cloning plasmid
CSB-CL883624HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1710
  • Sequence: ATGTTGCTCTTATTCAGTGTAATCCTAATCTCATGGGTATCCACTGTTGGGGGAGAAGGAACACTTTGTGATTTTCCAAAAATACACCATGGATTTCTGTATGATGAAGAAGATTATAACCCTTTTTCCCAAGTTCCTACAGGGGAAGTTTTCTATTACTCCTGTGAATATAATT
  • Show more
Description: A cloning plasmid for the CFHR5 gene.

Anti-CFHR5 antibody
STJ112404 100 µl
EUR 277
Description: This gene is a member of a small complement factor H (CFH) gene cluster on chromosome 1. Each member of this gene family contains multiple short consensus repeats (SCRs) typical of regulators of complement activation. The protein encoded by this gene has nine SCRs with the first two repeats having heparin binding properties, a region within repeats 5-7 having heparin binding and C reactive protein binding properties, and the C-terminal repeats being similar to a complement component 3 b (C3b) binding domain. This protein co-localizes with C3, binds C3b in a dose-dependent manner, and is recruited to tissues damaged by C-reactive protein. Allelic variations in this gene have been associated, but not causally linked, with two different forms of kidney disease: membranoproliferative glomerulonephritis type II (MPGNII) and hemolytic uraemic syndrome (HUS).

CFHR5 Recombinant Protein (Human)
RP038014 100 ug Ask for price

Complement Factor H-Related Protein 5 (CFHR5) Antibody
20-abx125662
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Complement Factor H-Related Protein 5 (CFHR5) Antibody
abx032588-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Complement Factor H-Related Protein 5 (CFHR5) Antibody
abx032588-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Complement Factor H Related Protein 5 (CFHR5) Antibody
20-abx175994
  • EUR 1316.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Complement Factor H-Related Protein 5 (CFHR5) Antibody
abx224257-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Complement Factor H-Related Protein 5 (CFHR5) Antibody
abx224397-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Complement Factor H Related Protein 5 (CFHR5) Antibody
20-abx171902
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Human Complement Factor H Related 5 (CFHR5) ELISA Kit
abx574038-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Complement Factor H Related Protein 5 (CFHR5) Protein
20-abx653034
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.