|
20-abx911595 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Abbexa Laboratories manufactures the abbexa cfhr5 reagents distributed by Genprice. The Abbexa Cfhr5 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Abbexa. Other Abbexa products are available in stock. Specificity: Abbexa Category: Cfhr5
Complement Factor H Related Protein 5 (CFHR5) Antibody |
Abbexa |
|
|
|
Complement Factor H-Related Protein 5 (CFHR5) Antibody |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Complement Factor H-Related Protein 5 (CFHR5) Antibody |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Complement Factor H Related Protein 5 (CFHR5) Antibody |
Abbexa |
|
|
|
Human Complement Factor H Related 5 (CFHR5) ELISA Kit |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Human Complement Factor H Related Protein 5 (CFHR5) Protein |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Complement Factor H Related Protein 5 (CFHR5) CLIA Kit |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Serum / Plasma information
CFHR5 Conjugated Antibody |
C48416 |
SAB |
100ul |
EUR 397 |
CFHR5 Rabbit pAb |
A10367-100ul |
Abclonal |
100 ul |
EUR 308 |
CFHR5 Rabbit pAb |
A10367-200ul |
Abclonal |
200 ul |
EUR 459 |
CFHR5 Rabbit pAb |
A10367-20ul |
Abclonal |
20 ul |
EUR 183 |
CFHR5 Rabbit pAb |
A10367-50ul |
Abclonal |
50 ul |
EUR 223 |
CFHR5 cloning plasmid |
CSB-CL883624HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1710
- Sequence: ATGTTGCTCTTATTCAGTGTAATCCTAATCTCATGGGTATCCACTGTTGGGGGAGAAGGAACACTTTGTGATTTTCCAAAAATACACCATGGATTTCTGTATGATGAAGAAGATTATAACCCTTTTTCCCAAGTTCCTACAGGGGAAGTTTTCTATTACTCCTGTGAATATAATT
- Show more
|
Description: A cloning plasmid for the CFHR5 gene. |
Anti-CFHR5 antibody |
STJ112404 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of a small complement factor H (CFH) gene cluster on chromosome 1. Each member of this gene family contains multiple short consensus repeats (SCRs) typical of regulators of complement activation. The protein encoded by this gene has nine SCRs with the first two repeats having heparin binding properties, a region within repeats 5-7 having heparin binding and C reactive protein binding properties, and the C-terminal repeats being similar to a complement component 3 b (C3b) binding domain. This protein co-localizes with C3, binds C3b in a dose-dependent manner, and is recruited to tissues damaged by C-reactive protein. Allelic variations in this gene have been associated, but not causally linked, with two different forms of kidney disease: membranoproliferative glomerulonephritis type II (MPGNII) and hemolytic uraemic syndrome (HUS). |
CFHR5 Recombinant Protein (Human) |
RP038014 |
ABM |
100 ug |
Ask for price |
Complement Factor H-Related Protein 5 (CFHR5) Antibody |
20-abx125662 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Complement Factor H-Related Protein 5 (CFHR5) Antibody |
abx032588-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Complement Factor H-Related Protein 5 (CFHR5) Antibody |
abx032588-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Complement Factor H Related Protein 5 (CFHR5) Antibody |
20-abx175994 |
Abbexa |
|
|
|
Complement Factor H-Related Protein 5 (CFHR5) Antibody |
abx224257-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Complement Factor H-Related Protein 5 (CFHR5) Antibody |
abx224397-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Complement Factor H Related Protein 5 (CFHR5) Antibody |
20-abx171902 |
Abbexa |
|
|
|
Human Complement Factor H Related 5 (CFHR5) ELISA Kit |
abx574038-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Human Complement Factor H Related Protein 5 (CFHR5) Protein |
20-abx653034 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|